Source of the materials: Biopython cookbook (adapted) Status: Draft
BLAST and other sequence search tools (experimental code)¶
WARNING: This chapter of the Tutorial describes an experimental
module in Biopython. It is being included in Biopython and documented
here in the tutorial in a pre-final state to allow a period of feedback
and refinement before we declare it stable. Until then the details will
probably change, and any scripts using the current Bio.SearchIO
would need to be updated. Please keep this in mind! For stable code
working with NCBI BLAST, please continue to use Bio.Blast described in
the preceding Chapter [chapter:blast].
Biological sequence identification is an integral part of bioinformatics. Several tools are available for this, each with their own algorithms and approaches, such as BLAST (arguably the most popular), FASTA, HMMER, and many more. In general, these tools usually use your sequence to search a database of potential matches. With the growing number of known sequences (hence the growing number of potential matches), interpreting the results becomes increasingly hard as there could be hundreds or even thousands of potential matches. Naturally, manual interpretation of these searches’ results is out of the question. Moreover, you often need to work with several sequence search tools, each with its own statistics, conventions, and output format. Imagine how daunting it would be when you need to work with multiple sequences using multiple search tools.
We know this too well ourselves, which is why we created the
Bio.SearchIO submodule in Biopython. Bio.SearchIO allows you to
extract information from your search results in a convenient way, while
also dealing with the different standards and conventions used by
different search tools. The name SearchIO is a homage to BioPerl’s
module of the same name.
In this chapter, we’ll go through the main features of Bio.SearchIO
to show what it can do for you. We’ll use two popular search tools along
the way: BLAST and BLAT. They are used merely for illustrative purposes,
and you should be able to adapt the workflow to any other search tools
supported by Bio.SearchIO in a breeze. You’re very welcome to follow
along with the search output files we’ll be using. The BLAST output file
can be downloaded
here, and the
BLAT output file
here. Both
output files were generated using this sequence:
>mystery_seq
CCCTCTACAGGGAAGCGCTTTCTGTTGTCTGAAAGAAAAGAAAGTGCTTCCTTTTAGAGGG
The BLAST result is an XML file generated using blastn against the
NCBI refseq_rna database. For BLAT, the sequence database was the
February 2009 hg19 human genome draft and the output format is PSL.
We’ll start from an introduction to the Bio.SearchIO object model.
The model is the representation of your search results, thus it is core
to Bio.SearchIO itself. After that, we’ll check out the main
functions in Bio.SearchIO that you may often use.
Now that we’re all set, let’s go to the first step: introducing the core object model.
The SearchIO object model¶
Despite the wildly differing output styles among many sequence search tools, it turns out that their underlying concept is similar:
- The output file may contain results from one or more search queries.
- In each search query, you will see one or more hits from the given search database.
- In each database hit, you will see one or more regions containing the actual sequence alignment between your query sequence and the database sequence.
- Some programs like BLAT or Exonerate may further split these regions into several alignment fragments (or blocks in BLAT and possibly exons in exonerate). This is not something you always see, as programs like BLAST and HMMER do not do this.
Realizing this generality, we decided use it as base for creating the
Bio.SearchIO object model. The object model consists of a nested
hierarchy of Python objects, each one representing one concept outlined
above. These objects are:
QueryResult, to represent a single search query.Hit, to represent a single database hit.Hitobjects are contained withinQueryResultand in eachQueryResultthere is zero or moreHitobjects.HSP(short for high-scoring pair), to represent region(s) of significant alignments between query and hit sequences.HSPobjects are contained withinHitobjects and eachHithas one or moreHSPobjects.HSPFragment, to represent a single contiguous alignment between query and hit sequences.HSPFragmentobjects are contained withinHSPobjects. Most sequence search tools like BLAST and HMMER unifyHSPandHSPFragmentobjects as eachHSPwill only have a singleHSPFragment. However there are tools like BLAT and Exonerate that produceHSPcontaining multipleHSPFragment. Don’t worry if this seems a tad confusing now, we’ll elaborate more on these two objects later on.
These four objects are the ones you will interact with when you use
Bio.SearchIO. They are created using one of the main
Bio.SearchIO methods: read, parse, index, or
index_db. The details of these methods are provided in later
sections. For this section, we’ll only be using read and parse. These
functions behave similarly to their Bio.SeqIO and Bio.AlignIO
counterparts:
readis used for search output files with a single query and returns aQueryResultobjectparseis used for search output files with multiple queries and returns a generator that yieldsQueryResultobjects
With that settled, let’s start probing each Bio.SearchIO object,
beginning with QueryResult.
QueryResult¶
The QueryResult object represents a single search query and contains zero or more Hit objects. Let’s see what it looks like using the BLAST file we have:
In [1]:
from Bio import SearchIO
blast_qresult = SearchIO.read('data/my_blast.xml', 'blast-xml')
print(blast_qresult)
Program: blastn (2.3.0+)
Query: gi|8332116|gb|BE037100.1|BE037100 (1111)
MP14H09 MP Mesembryanthemum crystallinum cDNA 5' similar to cold ac...
Target: nt
Hits: ---- ----- ----------------------------------------------------------
# # HSP ID + description
---- ----- ----------------------------------------------------------
0 1 gi|731339628|ref|XM_010682658.1| PREDICTED: Beta vulga...
1 1 gi|568824607|ref|XM_006466626.1| PREDICTED: Citrus sin...
2 1 gi|568824605|ref|XM_006466625.1| PREDICTED: Citrus sin...
3 1 gi|568824603|ref|XM_006466624.1| PREDICTED: Citrus sin...
4 1 gi|568824601|ref|XM_006466623.1| PREDICTED: Citrus sin...
5 1 gi|568824599|ref|XM_006466622.1| PREDICTED: Citrus sin...
6 1 gi|567866318|ref|XM_006425719.1| Citrus clementina hyp...
7 1 gi|567866316|ref|XM_006425718.1| Citrus clementina hyp...
8 1 gi|567866314|ref|XM_006425717.1| Citrus clementina hyp...
9 1 gi|567866312|ref|XM_006425716.1| Citrus clementina hyp...
10 1 gi|590704208|ref|XM_007047033.1| Theobroma cacao Cold-...
11 1 gi|590704205|ref|XM_007047032.1| Theobroma cacao Cold-...
12 1 gi|694428700|ref|XM_009343631.1| PREDICTED: Pyrus x br...
13 1 gi|694402986|ref|XM_009378191.1| PREDICTED: Pyrus x br...
14 1 gi|743838297|ref|XM_011027373.1| PREDICTED: Populus eu...
15 1 gi|743838293|ref|XM_011027372.1| PREDICTED: Populus eu...
16 1 gi|595807351|ref|XM_007202530.1| Prunus persica hypoth...
17 1 gi|566180892|ref|XM_006380679.1| Populus trichocarpa c...
18 1 gi|764593175|ref|XM_004300526.2| PREDICTED: Fragaria v...
19 1 gi|731440276|ref|XM_002274845.3| PREDICTED: Vitis vini...
20 1 gi|349709091|emb|FQ378501.1| Vitis vinifera clone SS0A...
21 1 gi|719997221|ref|XM_010256725.1| PREDICTED: Nelumbo nu...
22 1 gi|645272858|ref|XM_008243375.1| PREDICTED: Prunus mum...
23 1 gi|645272856|ref|XM_008243374.1| PREDICTED: Prunus mum...
24 1 gi|848856318|ref|XM_013000712.1| PREDICTED: Erythranth...
25 1 gi|255562758|ref|XM_002522339.1| Ricinus communis COR4...
26 1 gi|658006068|ref|XM_008339966.1| PREDICTED: Malus x do...
27 1 gi|802641059|ref|XM_012223735.1| PREDICTED: Jatropha c...
28 1 gi|802641054|ref|XM_012223734.1| PREDICTED: Jatropha c...
29 1 gi|823184330|ref|XM_012633708.1| PREDICTED: Gossypium ...
~~~
47 1 gi|729314350|ref|XM_010532905.1| PREDICTED: Tarenaya h...
48 1 gi|731383573|ref|XM_002284686.2| PREDICTED: Vitis vini...
49 1 gi|255762732|gb|GQ370517.1| Salvia miltiorrhiza cold a...
/home/tiago_antao/miniconda/lib/python3.5/site-packages/Bio/SearchIO/__init__.py:211: BiopythonExperimentalWarning: Bio.SearchIO is an experimental submodule which may undergo significant changes prior to its future official release.
BiopythonExperimentalWarning)
We’ve just begun to scratch the surface of the object model, but you can
see that there’s already some useful information. By invoking print
on the QueryResult object, you can see:
- The program name and version (blastn version 2.2.27+)
- The query ID, description, and its sequence length (ID is 42291, description is ‘mystery_seq’, and it is 61 nucleotides long)
- The target database to search against (refseq_rna)
- A quick overview of the resulting hits. For our query sequence, there
are 100 potential hits (numbered 0–99 in the table). For each hit, we
can also see how many HSPs it contains, its ID, and a snippet of its
description. Notice here that
Bio.SearchIOtruncates the hit table overview, by showing only hits numbered 0–29, and then 97–99.
Now let’s check our BLAT results using the same procedure as above:
In [2]:
blat_qresult = SearchIO.read('data/my_blat.psl', 'blat-psl')
print(blat_qresult)
Program: blat (<unknown version>)
Query: mystery_seq (61)
<unknown description>
Target: <unknown target>
Hits: ---- ----- ----------------------------------------------------------
# # HSP ID + description
---- ----- ----------------------------------------------------------
0 17 chr19 <unknown description>
You’ll immediately notice that there are some differences. Some of these are caused by the way PSL format stores its details, as you’ll see. The rest are caused by the genuine program and target database differences between our BLAST and BLAT searches:
- The program name and version.
Bio.SearchIOknows that the program is BLAT, but in the output file there is no information regarding the program version so it defaults to ‘<unknown version>’. - The query ID, description, and its sequence length. Notice here that these details are slightly different from the ones we saw in BLAST. The ID is ‘mystery_seq’ instead of 42991, there is no known description, but the query length is still 61. This is actually a difference introduced by the file formats themselves. BLAST sometimes creates its own query IDs and uses your original ID as the sequence description.
- The target database is not known, as it is not stated in the BLAT output file.
- And finally, the list of hits we have is completely different. Here, we see that our query sequence only hits the ‘chr19’ database entry, but in it we see 17 HSP regions. This should not be surprising however, given that we are using a different program, each with its own target database.
All the details you saw when invoking the print method can be
accessed individually using Python’s object attribute access notation
(a.k.a. the dot notation). There are also other format-specific
attributes that you can access using the same method.
In [3]:
print("%s %s" % (blast_qresult.program, blast_qresult.version))
blastn 2.3.0+
In [4]:
print("%s %s" % (blat_qresult.program, blat_qresult.version))
blat <unknown version>
In [5]:
blast_qresult.param_evalue_threshold # blast-xml specific
Out[5]:
10.0
For a complete list of accessible attributes, you can check each format-specific documentation. Here are the ones for BLAST and for BLAT.
Having looked at using print on QueryResult objects, let’s drill
down deeper. What exactly is a QueryResult? In terms of Python
objects, QueryResult is a hybrid between a list and a dictionary. In
other words, it is a container object with all the convenient features
of lists and dictionaries.
Like Python lists and dictionaries, QueryResult objects are
iterable. Each iteration returns a Hit object:
In [6]:
for hit in blast_qresult:
hit
To check how many items (hits) a QueryResult has, you can simply
invoke Python’s len method:
In [7]:
len(blast_qresult)
Out[7]:
50
In [8]:
len(blat_qresult)
Out[8]:
1
Like Python lists, you can retrieve items (hits) from a QueryResult
using the slice notation:
In [9]:
blast_qresult[0] # retrieves the top hit
Out[9]:
Hit(id='gi|731339628|ref|XM_010682658.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps)
In [10]:
blast_qresult[-1] # retrieves the last hit
Out[10]:
Hit(id='gi|255762732|gb|GQ370517.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps)
To retrieve multiple hits, you can slice QueryResult objects using
the slice notation as well. In this case, the slice will return a new
QueryResult object containing only the sliced hits:
In [11]:
blast_slice = blast_qresult[:3] # slices the first three hits
print(blast_slice)
Program: blastn (2.3.0+)
Query: gi|8332116|gb|BE037100.1|BE037100 (1111)
MP14H09 MP Mesembryanthemum crystallinum cDNA 5' similar to cold ac...
Target: nt
Hits: ---- ----- ----------------------------------------------------------
# # HSP ID + description
---- ----- ----------------------------------------------------------
0 1 gi|731339628|ref|XM_010682658.1| PREDICTED: Beta vulga...
1 1 gi|568824607|ref|XM_006466626.1| PREDICTED: Citrus sin...
2 1 gi|568824605|ref|XM_006466625.1| PREDICTED: Citrus sin...
Like Python dictionaries, you can also retrieve hits using the hit’s ID. This is particularly useful if you know a given hit ID exists within a search query results:
In [16]:
blast_qresult['gi|731339628|ref|XM_010682658.1|']
Out[16]:
Hit(id='gi|731339628|ref|XM_010682658.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps)
You can also get a full list of Hit objects using hits and a
full list of Hit IDs using hit_keys:
In [17]:
blast_qresult.hits
Out[17]:
[Hit(id='gi|731339628|ref|XM_010682658.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|568824607|ref|XM_006466626.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|568824605|ref|XM_006466625.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|568824603|ref|XM_006466624.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|568824601|ref|XM_006466623.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|568824599|ref|XM_006466622.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|567866318|ref|XM_006425719.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|567866316|ref|XM_006425718.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|567866314|ref|XM_006425717.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|567866312|ref|XM_006425716.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|590704208|ref|XM_007047033.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|590704205|ref|XM_007047032.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|694428700|ref|XM_009343631.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|694402986|ref|XM_009378191.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|743838297|ref|XM_011027373.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|743838293|ref|XM_011027372.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|595807351|ref|XM_007202530.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|566180892|ref|XM_006380679.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|764593175|ref|XM_004300526.2|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|731440276|ref|XM_002274845.3|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|349709091|emb|FQ378501.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|719997221|ref|XM_010256725.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|645272858|ref|XM_008243375.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|645272856|ref|XM_008243374.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|848856318|ref|XM_013000712.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|255562758|ref|XM_002522339.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|658006068|ref|XM_008339966.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|802641059|ref|XM_012223735.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|802641054|ref|XM_012223734.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|823184330|ref|XM_012633708.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|697116717|ref|XM_009613983.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|698554552|ref|XM_009771948.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|565355903|ref|XM_006344753.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|659079297|ref|XM_008441961.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|659079295|ref|XM_008441960.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|828326432|ref|XM_004509143.2|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|729300104|ref|XM_010559563.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|922336892|ref|XM_013590982.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|955375440|ref|XM_003548859.3|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|778718146|ref|XM_011659511.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|778718144|ref|XM_004141977.2|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|955306249|ref|XM_003519866.3|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|747102191|ref|XM_011100949.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|723677217|ref|XM_004233368.2|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|703126872|ref|XM_010105390.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|658037046|ref|XM_008355863.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|225311746|dbj|AK326681.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|729314350|ref|XM_010532905.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|731383573|ref|XM_002284686.2|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps),
Hit(id='gi|255762732|gb|GQ370517.1|', query_id='gi|8332116|gb|BE037100.1|BE037100', 1 hsps)]
In [18]:
blast_qresult.hit_keys
Out[18]:
['gi|731339628|ref|XM_010682658.1|',
'gi|568824607|ref|XM_006466626.1|',
'gi|568824605|ref|XM_006466625.1|',
'gi|568824603|ref|XM_006466624.1|',
'gi|568824601|ref|XM_006466623.1|',
'gi|568824599|ref|XM_006466622.1|',
'gi|567866318|ref|XM_006425719.1|',
'gi|567866316|ref|XM_006425718.1|',
'gi|567866314|ref|XM_006425717.1|',
'gi|567866312|ref|XM_006425716.1|',
'gi|590704208|ref|XM_007047033.1|',
'gi|590704205|ref|XM_007047032.1|',
'gi|694428700|ref|XM_009343631.1|',
'gi|694402986|ref|XM_009378191.1|',
'gi|743838297|ref|XM_011027373.1|',
'gi|743838293|ref|XM_011027372.1|',
'gi|595807351|ref|XM_007202530.1|',
'gi|566180892|ref|XM_006380679.1|',
'gi|764593175|ref|XM_004300526.2|',
'gi|731440276|ref|XM_002274845.3|',
'gi|349709091|emb|FQ378501.1|',
'gi|719997221|ref|XM_010256725.1|',
'gi|645272858|ref|XM_008243375.1|',
'gi|645272856|ref|XM_008243374.1|',
'gi|848856318|ref|XM_013000712.1|',
'gi|255562758|ref|XM_002522339.1|',
'gi|658006068|ref|XM_008339966.1|',
'gi|802641059|ref|XM_012223735.1|',
'gi|802641054|ref|XM_012223734.1|',
'gi|823184330|ref|XM_012633708.1|',
'gi|697116717|ref|XM_009613983.1|',
'gi|698554552|ref|XM_009771948.1|',
'gi|565355903|ref|XM_006344753.1|',
'gi|659079297|ref|XM_008441961.1|',
'gi|659079295|ref|XM_008441960.1|',
'gi|828326432|ref|XM_004509143.2|',
'gi|729300104|ref|XM_010559563.1|',
'gi|922336892|ref|XM_013590982.1|',
'gi|955375440|ref|XM_003548859.3|',
'gi|778718146|ref|XM_011659511.1|',
'gi|778718144|ref|XM_004141977.2|',
'gi|955306249|ref|XM_003519866.3|',
'gi|747102191|ref|XM_011100949.1|',
'gi|723677217|ref|XM_004233368.2|',
'gi|703126872|ref|XM_010105390.1|',
'gi|658037046|ref|XM_008355863.1|',
'gi|225311746|dbj|AK326681.1|',
'gi|729314350|ref|XM_010532905.1|',
'gi|731383573|ref|XM_002284686.2|',
'gi|255762732|gb|GQ370517.1|']
What if you just want to check whether a particular hit is present in
the query results? You can do a simple Python membership test using the
in keyword:
In [19]:
'gi|262205317|ref|NR_030195.1|' in blast_qresult
Out[19]:
False
In [21]:
'gi|731339628|ref|XM_010682658.1|' in blast_qresult
Out[21]:
True
Sometimes, knowing whether a hit is present is not enough; you also want
to know the rank of the hit. Here, the index method comes to the
rescue:
In [23]:
blast_qresult.index('gi|595807351|ref|XM_007202530.1|')
Out[23]:
16
Remember that we’re using Python’s indexing style here, which is zero-based. This means our hit above is ranked at no. 23, not 22.
Also, note that the hit rank you see here is based on the native hit ordering present in the original search output file. Different search tools may order these hits based on different criteria.
If the native hit ordering doesn’t suit your taste, you can use the
sort method of the QueryResult object. It is very similar to
Python’s list.sort method, with the addition of an option to create
a new sorted QueryResult object or not.
Here is an example of using QueryResult.sort to sort the hits based
on each hit’s full sequence length. For this particular sort, we’ll set
the in_place flag to False so that sorting will return a new
QueryResult object and leave our initial object unsorted. We’ll also
set the reverse flag to True so that we sort in descending
order.
In [24]:
for hit in blast_qresult[:5]: # id and sequence length of the first five hits
print("%s %i" % (hit.id, hit.seq_len))
gi|731339628|ref|XM_010682658.1| 847
gi|568824607|ref|XM_006466626.1| 878
gi|568824605|ref|XM_006466625.1| 911
gi|568824603|ref|XM_006466624.1| 894
gi|568824601|ref|XM_006466623.1| 922
In [25]:
sort_key = lambda hit: hit.seq_len
sorted_qresult = blast_qresult.sort(key=sort_key, reverse=True, in_place=False)
for hit in sorted_qresult[:5]:
print("%s %i" % (hit.id, hit.seq_len))
gi|955306249|ref|XM_003519866.3| 1388
gi|659079295|ref|XM_008441960.1| 1245
gi|567866316|ref|XM_006425718.1| 1202
gi|566180892|ref|XM_006380679.1| 1182
gi|565355903|ref|XM_006344753.1| 1153
The advantage of having the in_place flag here is that we’re
preserving the native ordering, so we may use it again later. You should
note that this is not the default behavior of QueryResult.sort,
however, which is why we needed to set the in_place flag to True
explicitly.
At this point, you’ve known enough about QueryResult objects to make
it work for you. But before we go on to the next object in the
Bio.SearchIO model, let’s take a look at two more sets of methods
that could make it even easier to work with QueryResult objects: the
filter and map methods.
If you’re familiar with Python’s list comprehensions, generator
expressions or the built in filter and map functions, you’ll
know how useful they are for working with list-like objects (if you’re
not, check them out!). You can use these built in methods to manipulate
QueryResult objects, but you’ll end up with regular Python lists and
lose the ability to do more interesting manipulations.
That’s why, QueryResult objects provide its own flavor of filter
and map methods. Analogous to filter, there are hit_filter
and hsp_filter methods. As their name implies, these methods filter
its QueryResult object either on its Hit objects or HSP
objects. Similarly, analogous to map, QueryResult objects also
provide the hit_map and hsp_map methods. These methods apply a
given function to all hits or HSPs in a QueryResult object,
respectively.
Let’s see these methods in action, beginning with hit_filter. This
method accepts a callback function that checks whether a given Hit
object passes the condition you set or not. In other words, the function
must accept as its argument a single Hit object and returns True
or False.
Here is an example of using hit_filter to filter out Hit objects
that only have one HSP:
In [26]:
filter_func = lambda hit: len(hit.hsps) > 1 # the callback function
len(blast_qresult) # no. of hits before filtering
Out[26]:
50
In [27]:
filtered_qresult = blast_qresult.hit_filter(filter_func)
len(filtered_qresult) # no. of hits after filtering
Out[27]:
0
In [28]:
for hit in filtered_qresult[:5]: # quick check for the hit lengths
print("%s %i" % (hit.id, len(hit.hsps)))
hsp_filter works the same as hit_filter, only instead of looking
at the Hit objects, it performs filtering on the HSP objects in
each hits.
As for the map methods, they too accept a callback function as their
arguments. However, instead of returning True or False, the
callback function must return the modified Hit or HSP object
(depending on whether you’re using hit_map or hsp_map).
Let’s see an example where we’re using hit_map to rename the hit
IDs:
In [29]:
def map_func(hit):
hit.id = hit.id.split('|')[3] # renames 'gi|301171322|ref|NR_035857.1|' to 'NR_035857.1'
return hit
mapped_qresult = blast_qresult.hit_map(map_func)
for hit in mapped_qresult[:5]:
print(hit.id)
XM_010682658.1
XM_006466626.1
XM_006466625.1
XM_006466624.1
XM_006466623.1
Again, hsp_map works the same as hit_map, but on HSP objects
instead of Hit objects.
Hit¶
Hit objects represent all query results from a single database
entry. They are the second-level container in the Bio.SearchIO
object hierarchy. You’ve seen that they are contained by QueryResult
objects, but they themselves contain HSP objects.
Let’s see what they look like, beginning with our BLAST search:
In [30]:
from Bio import SearchIO
blast_qresult = SearchIO.read('data/my_blast.xml', 'blast-xml')
blast_hit = blast_qresult[3] # fourth hit from the query result
print(blast_hit)
Query: gi|8332116|gb|BE037100.1|BE037100
MP14H09 MP Mesembryanthemum crystallinum cDNA 5' similar to cold accl...
Hit: gi|568824603|ref|XM_006466624.1| (894)
PREDICTED: Citrus sinensis cold-regulated 413 plasma membrane protein...
HSPs: ---- -------- --------- ------ --------------- ---------------------
# E-value Bit score Span Query range Hit range
---- -------- --------- ------ --------------- ---------------------
0 6.9e-99 372.78 596 [63:655] [108:697]
You see that we’ve got the essentials covered here:
- The query ID and description is present. A hit is always tied to a
query, so we want to keep track of the originating query as well.
These values can be accessed from a hit using the
query_idandquery_descriptionattributes. - We also have the unique hit ID, description, and full sequence
lengths. They can be accessed using
id,description, andseq_len, respectively. - Finally, there’s a table containing quick information about the HSPs this hit contains. In each row, we’ve got the important HSP details listed: the HSP index, its e-value, its bit score, its span (the alignment length including gaps), its query coordinates, and its hit coordinates.
Now let’s contrast this with the BLAT search. Remember that in the BLAT search we had one hit with 17 HSPs.
In [31]:
blat_qresult = SearchIO.read('data/my_blat.psl', 'blat-psl')
blat_hit = blat_qresult[0] # the only hit
print(blat_hit)
Query: mystery_seq
<unknown description>
Hit: chr19 (59128983)
<unknown description>
HSPs: ---- -------- --------- ------ --------------- ---------------------
# E-value Bit score Span Query range Hit range
---- -------- --------- ------ --------------- ---------------------
0 ? ? ? [0:61] [54204480:54204541]
1 ? ? ? [0:61] [54233104:54264463]
2 ? ? ? [0:61] [54254477:54260071]
3 ? ? ? [1:61] [54210720:54210780]
4 ? ? ? [0:60] [54198476:54198536]
5 ? ? ? [0:61] [54265610:54265671]
6 ? ? ? [0:61] [54238143:54240175]
7 ? ? ? [0:60] [54189735:54189795]
8 ? ? ? [0:61] [54185425:54185486]
9 ? ? ? [0:60] [54197657:54197717]
10 ? ? ? [0:61] [54255662:54255723]
11 ? ? ? [0:61] [54201651:54201712]
12 ? ? ? [8:60] [54206009:54206061]
13 ? ? ? [10:61] [54178987:54179038]
14 ? ? ? [8:61] [54212018:54212071]
15 ? ? ? [8:51] [54234278:54234321]
16 ? ? ? [8:61] [54238143:54238196]
Here, we’ve got a similar level of detail as with the BLAST hit we saw earlier. There are some differences worth explaining, though:
- The e-value and bit score column values. As BLAT HSPs do not have e-values and bit scores, the display defaults to ‘?’.
- What about the span column? The span values is meant to display the
complete alignment length, which consists of all residues and any
gaps that may be present. The PSL format do not have this information
readily available and
Bio.SearchIOdoes not attempt to try guess what it is, so we get a ‘?’ similar to the e-value and bit score columns.
In terms of Python objects, Hit behaves almost the same as Python
lists, but contain HSP objects exclusively. If you’re familiar with
lists, you should encounter no difficulties working with the Hit
object.
Just like Python lists, Hit objects are iterable, and each iteration
returns one HSP object it contains:
In [32]:
for hsp in blast_hit:
hsp
You can invoke len on a Hit to see how many HSP objects it
has:
In [33]:
len(blast_hit)
Out[33]:
1
In [34]:
len(blat_hit)
Out[34]:
17
You can use the slice notation on Hit objects, whether to retrieve
single HSP or multiple HSP objects. Like QueryResult, if you
slice for multiple HSP, a new Hit object will be returned
containing only the sliced HSP objects:
In [35]:
blat_hit[0] # retrieve single items
Out[35]:
HSP(hit_id='chr19', query_id='mystery_seq', 1 fragments)
In [36]:
sliced_hit = blat_hit[4:9] # retrieve multiple items
len(sliced_hit)
Out[36]:
5
In [37]:
print(sliced_hit)
Query: mystery_seq
<unknown description>
Hit: chr19 (59128983)
<unknown description>
HSPs: ---- -------- --------- ------ --------------- ---------------------
# E-value Bit score Span Query range Hit range
---- -------- --------- ------ --------------- ---------------------
0 ? ? ? [0:60] [54198476:54198536]
1 ? ? ? [0:61] [54265610:54265671]
2 ? ? ? [0:61] [54238143:54240175]
3 ? ? ? [0:60] [54189735:54189795]
4 ? ? ? [0:61] [54185425:54185486]
You can also sort the HSP inside a Hit, using the exact same
arguments like the sort method you saw in the QueryResult object.
Finally, there are also the filter and map methods you can use
on Hit objects. Unlike in the QueryResult object, Hit
objects only have one variant of filter (Hit.filter) and one
variant of map (Hit.map). Both of Hit.filter and Hit.map
work on the HSP objects a Hit has.
HSP¶
HSP (high-scoring pair) represents region(s) in the hit sequence
that contains significant alignment(s) to the query sequence. It
contains the actual match between your query sequence and a database
entry. As this match is determined by the sequence search tool’s
algorithms, the HSP object contains the bulk of the statistics
computed by the search tool. This also makes the distinction between
HSP objects from different search tools more apparent compared to
the differences you’ve seen in QueryResult or Hit objects.
Let’s see some examples from our BLAST and BLAT searches. We’ll look at the BLAST HSP first:
In [38]:
from Bio import SearchIO
blast_qresult = SearchIO.read('data/my_blast.xml', 'blast-xml')
blast_hsp = blast_qresult[0][0] # first hit, first hsp
print(blast_hsp)
Query: gi|8332116|gb|BE037100.1|BE037100 MP14H09 MP Mesembryanthemum cr...
Hit: gi|731339628|ref|XM_010682658.1| PREDICTED: Beta vulgaris subsp....
Query range: [86:679] (1)
Hit range: [80:677] (1)
Quick stats: evalue 1.2e-108; bitscore 405.24
Fragments: 1 (597 columns)
Query - TTGGCCATGAAAACTGATCAATTGGCCGTGGCTAATATGATCGATTCCGATATCAATGA~~~TGTAG
||||||||||||||||| ||| |||| |||||||| |||| |||| ||||| |||||~~~|||||
Hit - TTGGCCATGAAAACTGAGCAAATGGCGTTGGCTAATTTGATAGATTATGATATGAATGA~~~TGTAG
Just like QueryResult and Hit, invoking print on an HSP
shows its general details:
- There are the query and hit IDs and descriptions. We need these to
identify our
HSP. - We’ve also got the matching range of the query and hit sequences. The slice notation we’re using here is an indication that the range is displayed using Python’s indexing style (zero-based, half open). The number inside the parenthesis denotes the strand. In this case, both sequences have the plus strand.
- Some quick statistics are available: the e-value and bitscore.
- There is information about the HSP fragments. Ignore this for now; it will be explained later on.
- And finally, we have the query and hit sequence alignment itself.
These details can be accessed on their own using the dot notation, just
like in QueryResult and Hit:
In [39]:
blast_hsp.query_range
Out[39]:
(86, 679)
In [40]:
blast_hsp.evalue
Out[40]:
1.1684e-108
They’re not the only attributes available, though. HSP objects come
with a default set of properties that makes it easy to probe their
various details. Here are some examples:
In [41]:
blast_hsp.hit_start # start coordinate of the hit sequence
Out[41]:
80
In [42]:
def map_func(hit):
hit.id = hit.id.split('|')[3] # renames 'gi|301171322|ref|NR_035857.1|' to 'NR_035857.1'
return hitblast_hsp.query_span # how many residues in the query sequence
In [43]:
blast_hsp.aln_span # how long the alignment is
Out[43]:
597
Check out the HSP
documentation
for a full list of these predefined properties.
Furthermore, each sequence search tool usually computes its own
statistics / details for its HSP objects. For example, an XML BLAST
search also outputs the number of gaps and identical residues. These
attributes can be accessed like so:
In [44]:
blast_hsp.gap_num # number of gaps
Out[44]:
4
In [45]:
blast_hsp.ident_num # number of identical residues
Out[45]:
449
These details are format-specific; they may not be present in other
formats. To see which details are available for a given sequence search
tool, you should check the format’s documentation in Bio.SearchIO.
Alternatively, you may also use .__dict__.keys() for a quick list of
what’s available:
In [46]:
blast_hsp.__dict__.keys()
Out[46]:
dict_keys(['_items', 'pos_num', 'gap_num', 'bitscore', 'bitscore_raw', 'ident_num', 'evalue'])
Finally, you may have noticed that the query and hit attributes
of our HSP are not just regular strings:
In [47]:
blast_hsp.query
Out[47]:
SeqRecord(seq=Seq('TTGGCCATGAAAACTGATCAATTGGCCGTGGCTAATATGATCGATTCCGATATC...TAG', DNAAlphabet()), id='gi|8332116|gb|BE037100.1|BE037100', name='aligned query sequence', description="MP14H09 MP Mesembryanthemum crystallinum cDNA 5' similar to cold acclimation protein, mRNA sequence", dbxrefs=[])
In [48]:
blast_hsp.hit
Out[48]:
SeqRecord(seq=Seq('TTGGCCATGAAAACTGAGCAAATGGCGTTGGCTAATTTGATAGATTATGATATG...TAG', DNAAlphabet()), id='gi|731339628|ref|XM_010682658.1|', name='aligned hit sequence', description='PREDICTED: Beta vulgaris subsp. vulgaris cold-regulated 413 plasma membrane protein 2 (LOC104895996), mRNA', dbxrefs=[])
They are SeqRecord objects you saw earlier in
Section [chapter:SeqRecord]! This means that you can do all sorts of
interesting things you can do with SeqRecord objects on
HSP.query and/or HSP.hit.
It should not surprise you now that the HSP object has an
alignment property which is a MultipleSeqAlignment object:
In [49]:
print(blast_hsp.aln)
DNAAlphabet() alignment with 2 rows and 597 columns
TTGGCCATGAAAACTGATCAATTGGCCGTGGCTAATATGATCGA...TAG gi|8332116|gb|BE037100.1|BE037100
TTGGCCATGAAAACTGAGCAAATGGCGTTGGCTAATTTGATAGA...TAG gi|731339628|ref|XM_010682658.1|
Having probed the BLAST HSP, let’s now take a look at HSPs from our BLAT
results for a different kind of HSP. As usual, we’ll begin by invoking
print on it:
In [50]:
blat_qresult = SearchIO.read('data/my_blat.psl', 'blat-psl')
blat_hsp = blat_qresult[0][0] # first hit, first hsp
print(blat_hsp)
Query: mystery_seq <unknown description>
Hit: chr19 <unknown description>
Query range: [0:61] (1)
Hit range: [54204480:54204541] (1)
Quick stats: evalue ?; bitscore ?
Fragments: 1 (? columns)
Some of the outputs you may have already guessed. We have the query and
hit IDs and descriptions and the sequence coordinates. Values for evalue
and bitscore is ‘?’ as BLAT HSPs do not have these attributes. But The
biggest difference here is that you don’t see any sequence alignments
displayed. If you look closer, PSL formats themselves do not have any
hit or query sequences, so Bio.SearchIO won’t create any sequence or
alignment objects. What happens if you try to access HSP.query,
HSP.hit, or HSP.aln? You’ll get the default values for these
attributes, which is None:
In [51]:
blat_hsp.hit is None
Out[51]:
True
In [52]:
blat_hsp.query is None
Out[52]:
True
In [53]:
blat_hsp.aln is None
Out[53]:
True
This does not affect other attributes, though. For example, you can
still access the length of the query or hit alignment. Despite not
displaying any attributes, the PSL format still have this information so
Bio.SearchIO can extract them:
In [54]:
blat_hsp.query_span # length of query match
Out[54]:
61
In [55]:
blat_hsp.hit_span # length of hit match
Out[55]:
61
Other format-specific attributes are still present as well:
In [56]:
blat_hsp.score # PSL score
Out[56]:
61
In [57]:
blat_hsp.mismatch_num # the mismatch column
Out[57]:
0
So far so good? Things get more interesting when you look at another ‘variant’ of HSP present in our BLAT results. You might recall that in BLAT searches, sometimes we get our results separated into ‘blocks’. These blocks are essentially alignment fragments that may have some intervening sequence between them.
Let’s take a look at a BLAT HSP that contains multiple blocks to see how
Bio.SearchIO deals with this:
In [58]:
blat_hsp2 = blat_qresult[0][1] # first hit, second hsp
print(blat_hsp2)
Query: mystery_seq <unknown description>
Hit: chr19 <unknown description>
Query range: [0:61] (1)
Hit range: [54233104:54264463] (1)
Quick stats: evalue ?; bitscore ?
Fragments: --- -------------- ---------------------- ----------------------
# Span Query range Hit range
--- -------------- ---------------------- ----------------------
0 ? [0:18] [54233104:54233122]
1 ? [18:61] [54264420:54264463]
What’s happening here? We still some essential details covered: the IDs and descriptions, the coordinates, and the quick statistics are similar to what you’ve seen before. But the fragments detail is all different. Instead of showing ‘Fragments: 1’, we now have a table with two data rows.
This is how Bio.SearchIO deals with HSPs having multiple fragments.
As mentioned before, an HSP alignment may be separated by intervening
sequences into fragments. The intervening sequences are not part of the
query-hit match, so they should not be considered part of query nor hit
sequence. However, they do affect how we deal with sequence coordinates,
so we can’t ignore them.
Take a look at the hit coordinate of the HSP above. In the
Hit range: field, we see that the coordinate is
[54233104:54264463]. But looking at the table rows, we see that not
the entire region spanned by this coordinate matches our query.
Specifically, the intervening region spans from 54233122 to
54264420.
Why then, is the query coordinates seem to be contiguous, you ask? This is perfectly fine. In this case it means that the query match is contiguous (no intervening regions), while the hit match is not.
All these attributes are accessible from the HSP directly, by the way:
In [59]:
blat_hsp2.hit_range # hit start and end coordinates of the entire HSP
Out[59]:
(54233104, 54264463)
In [60]:
blat_hsp2.hit_range_all # hit start and end coordinates of each fragment
Out[60]:
[(54233104, 54233122), (54264420, 54264463)]
In [61]:
blat_hsp2.hit_span # hit span of the entire HSP
Out[61]:
31359
In [62]:
blat_hsp2.hit_span_all # hit span of each fragment
Out[62]:
[18, 43]
In [63]:
blat_hsp2.hit_inter_ranges # start and end coordinates of intervening regions in the hit sequence
Out[63]:
[(54233122, 54264420)]
In [64]:
blat_hsp2.hit_inter_spans # span of intervening regions in the hit sequence
Out[64]:
[31298]
Most of these attributes are not readily available from the PSL file we
have, but Bio.SearchIO calculates them for you on the fly when you
parse the PSL file. All it needs are the start and end coordinates of
each fragment.
What about the query, hit, and aln attributes? If the HSP
has multiple fragments, you won’t be able to use these attributes as
they only fetch single SeqRecord or MultipleSeqAlignment
objects. However, you can use their *_all counterparts:
query_all, hit_all, and aln_all. These properties will
return a list containing SeqRecord or MultipleSeqAlignment
objects from each of the HSP fragment. There are other attributes that
behave similarly, i.e. they only work for HSPs with one fragment. Check
out the HSP
documentation
for a full list.
Finally, to check whether you have multiple fragments or not, you can
use the is_fragmented property like so:
In [65]:
blat_hsp2.is_fragmented # BLAT HSP with 2 fragments
Out[65]:
True
In [66]:
blat_hsp.is_fragmented # BLAT HSP from earlier, with one fragment
Out[66]:
False
Before we move on, you should also know that we can use the slice
notation on HSP objects, just like QueryResult or Hit
objects. When you use this notation, you’ll get an HSPFragment
object in return, the last component of the object model.
HSPFragment¶
HSPFragment represents a single, contiguous match between the query
and hit sequences. You could consider it the core of the object model
and search result, since it is the presence of these fragments that
determine whether your search have results or not.
In most cases, you don’t have to deal with HSPFragment objects
directly since not that many sequence search tools fragment their HSPs.
When you do have to deal with them, what you should remember is that
HSPFragment objects were written with to be as compact as possible.
In most cases, they only contain attributes directly related to
sequences: strands, reading frames, alphabets, coordinates, the
sequences themselves, and their IDs and descriptions.
These attributes are readily shown when you invoke print on an
HSPFragment. Here’s an example, taken from our BLAST search:
In [67]:
from Bio import SearchIO
blast_qresult = SearchIO.read('data/my_blast.xml', 'blast-xml')
blast_frag = blast_qresult[0][0][0] # first hit, first hsp, first fragment
print(blast_frag)
Query: gi|8332116|gb|BE037100.1|BE037100 MP14H09 MP Mesembryanthemum cr...
Hit: gi|731339628|ref|XM_010682658.1| PREDICTED: Beta vulgaris subsp....
Query range: [86:679] (1)
Hit range: [80:677] (1)
Fragments: 1 (597 columns)
Query - TTGGCCATGAAAACTGATCAATTGGCCGTGGCTAATATGATCGATTCCGATATCAATGA~~~TGTAG
||||||||||||||||| ||| |||| |||||||| |||| |||| ||||| |||||~~~|||||
Hit - TTGGCCATGAAAACTGAGCAAATGGCGTTGGCTAATTTGATAGATTATGATATGAATGA~~~TGTAG
At this level, the BLAT fragment looks quite similar to the BLAST fragment, save for the query and hit sequences which are not present:
In [68]:
blat_qresult = SearchIO.read('data/my_blat.psl', 'blat-psl')
blat_frag = blat_qresult[0][0][0] # first hit, first hsp, first fragment
print(blat_frag)
Query: mystery_seq <unknown description>
Hit: chr19 <unknown description>
Query range: [0:61] (1)
Hit range: [54204480:54204541] (1)
Fragments: 1 (? columns)
In all cases, these attributes are accessible using our favorite dot notation. Some examples:
In [69]:
blast_frag.query_start # query start coordinate
Out[69]:
86
In [70]:
blast_frag.hit_strand # hit sequence strand
Out[70]:
1
In [71]:
blast_frag.hit # hit sequence, as a SeqRecord object
Out[71]:
SeqRecord(seq=Seq('TTGGCCATGAAAACTGAGCAAATGGCGTTGGCTAATTTGATAGATTATGATATG...TAG', DNAAlphabet()), id='gi|731339628|ref|XM_010682658.1|', name='aligned hit sequence', description='PREDICTED: Beta vulgaris subsp. vulgaris cold-regulated 413 plasma membrane protein 2 (LOC104895996), mRNA', dbxrefs=[])
A note about standards and conventions¶
Before we move on to the main functions, there is something you ought to
know about the standards Bio.SearchIO uses. If you’ve worked with
multiple sequence search tools, you might have had to deal with the many
different ways each program deals with things like sequence coordinates.
It might not have been a pleasant experience as these search tools
usually have their own standards. For example, one tools might use
one-based coordinates, while the other uses zero-based coordinates. Or,
one program might reverse the start and end coordinates if the strand is
minus, while others don’t. In short, these often creates unnecessary
mess must be dealt with.
We realize this problem ourselves and we intend to address it in
Bio.SearchIO. After all, one of the goals of Bio.SearchIO is to
create a common, easy to use interface to deal with various search
output files. This means creating standards that extend beyond the
object model you just saw.
Now, you might complain, “Not another standard!”. Well, eventually we have to choose one convention or the other, so this is necessary. Plus, we’re not creating something entirely new here; just adopting a standard we think is best for a Python programmer (it is Biopython, after all).
There are three implicit standards that you can expect when working with
Bio.SearchIO:
- The first one pertains to sequence coordinates. In
Bio.SearchIO, all sequence coordinates follows Python’s coordinate style: zero-based and half open. For example, if in a BLAST XML output file the start and end coordinates of an HSP are 10 and 28, they would become 9 and 28 inBio.SearchIO. The start coordinate becomes 9 because Python indices start from zero, while the end coordinate remains 28 as Python slices omit the last item in an interval. - The second is on sequence coordinate orders. In
Bio.SearchIO, start coordinates are always less than or equal to end coordinates. This isn’t always the case with all sequence search tools, as some of them have larger start coordinates when the sequence strand is minus. - The last one is on strand and reading frame values. For strands,
there are only four valid choices:
1(plus strand),-1(minus strand),0(protein sequences), andNone(no strand). For reading frames, the valid choices are integers from-3to3andNone.
Note that these standards only exist in Bio.SearchIO objects. If you
write Bio.SearchIO objects into an output format, Bio.SearchIO
will use the format’s standard for the output. It does not force its
standard over to your output file.
Reading search output files¶
There are two functions you can use for reading search output files into
Bio.SearchIO objects: read and parse. They’re essentially
similar to read and parse functions in other submodules like
Bio.SeqIO or Bio.AlignIO. In both cases, you need to supply the
search output file name and the file format name, both as Python
strings. You can check the documentation for a list of format names
Bio.SearchIO recognizes.
Bio.SearchIO.read is used for reading search output files with only
one query and returns a QueryResult object. You’ve seen read
used in our previous examples. What you haven’t seen is that read
may also accept additional keyword arguments, depending on the file
format.
Here are some examples. In the first one, we use read just like
previously to read a BLAST tabular output file. In the second one, we
use a keyword argument to modify so it parses the BLAST tabular variant
with comments in it:
In [73]:
from Bio import SearchIO
qresult = SearchIO.read('data/tab_2226_tblastn_003.txt', 'blast-tab')
qresult
Out[73]:
QueryResult(id='gi|16080617|ref|NP_391444.1|', 3 hits)
In [75]:
qresult2 = SearchIO.read('data/tab_2226_tblastn_007.txt', 'blast-tab', comments=True)
qresult2
Out[75]:
QueryResult(id='gi|16080617|ref|NP_391444.1|', 3 hits)
These keyword arguments differs among file formats. Check the format documentation to see if it has keyword arguments that modifies its parser’s behavior.
As for the Bio.SearchIO.parse, it is used for reading search output
files with any number of queries. The function returns a generator
object that yields a QueryResult object in each iteration. Like
Bio.SearchIO.read, it also accepts format-specific keyword
arguments:
In [77]:
from Bio import SearchIO
qresults = SearchIO.parse('data/tab_2226_tblastn_001.txt', 'blast-tab')
for qresult in qresults:
print(qresult.id)
gi|16080617|ref|NP_391444.1|
gi|11464971:4-101
In [78]:
qresults2 = SearchIO.parse('data/tab_2226_tblastn_005.txt', 'blast-tab', comments=True)
for qresult in qresults2:
print(qresult.id)
random_s00
gi|16080617|ref|NP_391444.1|
gi|11464971:4-101
Dealing with large search output files with indexing¶
Sometimes, you’re handed a search output file containing hundreds or
thousands of queries that you need to parse. You can of course use
Bio.SearchIO.parse for this file, but that would be grossly
inefficient if you need to access only a few of the queries. This is
because parse will parse all queries it sees before it fetches your
query of interest.
In this case, the ideal choice would be to index the file using
Bio.SearchIO.index or Bio.SearchIO.index_db. If the names sound
familiar, it’s because you’ve seen them before in
Section [sec:SeqIO-index]. These functions also behave similarly to
their Bio.SeqIO counterparts, with the addition of format-specific
keyword arguments.
Here are some examples. You can use index with just the filename and
format name:
In [79]:
from Bio import SearchIO
idx = SearchIO.index('data/tab_2226_tblastn_001.txt', 'blast-tab')
sorted(idx.keys())
Out[79]:
['gi|11464971:4-101', 'gi|16080617|ref|NP_391444.1|']
In [80]:
idx['gi|16080617|ref|NP_391444.1|']
Out[80]:
QueryResult(id='gi|16080617|ref|NP_391444.1|', 3 hits)
In [81]:
idx.close()
Or also with the format-specific keyword argument:
In [82]:
idx = SearchIO.index('data/tab_2226_tblastn_005.txt', 'blast-tab', comments=True)
sorted(idx.keys())
Out[82]:
['gi|11464971:4-101', 'gi|16080617|ref|NP_391444.1|', 'random_s00']
In [83]:
idx['gi|16080617|ref|NP_391444.1|']
Out[83]:
QueryResult(id='gi|16080617|ref|NP_391444.1|', 3 hits)
In [84]:
idx.close()
Or with the key_function argument, as in Bio.SeqIO:
In [85]:
key_function = lambda id: id.upper() # capitalizes the keys
idx = SearchIO.index('data/tab_2226_tblastn_001.txt', 'blast-tab', key_function=key_function)
sorted(idx.keys())
Out[85]:
['GI|11464971:4-101', 'GI|16080617|REF|NP_391444.1|']
In [86]:
idx['GI|16080617|REF|NP_391444.1|']
Out[86]:
QueryResult(id='gi|16080617|ref|NP_391444.1|', 3 hits)
In [87]:
idx.close()
Bio.SearchIO.index_db works like as index, only it writes the
query offsets into an SQLite database file.
Writing and converting search output files¶
It is occasionally useful to be able to manipulate search results from
an output file and write it again to a new file. Bio.SearchIO
provides a write function that lets you do exactly this. It takes as
its arguments an iterable returning QueryResult objects, the output
filename to write to, the format name to write to, and optionally some
format-specific keyword arguments. It returns a four-item tuple, which
denotes the number or QueryResult, Hit, HSP, and
HSPFragment objects that were written.
In [88]:
from Bio import SearchIO
qresults = SearchIO.parse('data/mirna.xml', 'blast-xml') # read XML file
SearchIO.write(qresults, 'results.tab', 'blast-tab') # write to tabular file
Out[88]:
(3, 239, 277, 277)
You should note different file formats require different attributes of
the QueryResult, Hit, HSP and HSPFragment objects. If
these attributes are not present, writing won’t work. In other words,
you can’t always write to the output format that you want. For example,
if you read a BLAST XML file, you wouldn’t be able to write the results
to a PSL file as PSL files require attributes not calculated by BLAST
(e.g. the number of repeat matches). You can always set these attributes
manually, if you really want to write to PSL, though.
Like read, parse, index, and index_db, write also
accepts format-specific keyword arguments. Check out the documentation
for a complete list of formats Bio.SearchIO can write to and their
arguments.
Finally, Bio.SearchIO also provides a convert function, which is
simply a shortcut for Bio.SearchIO.parse and Bio.SearchIO.write.
Using the convert function, our example above would be:
In [89]:
from Bio import SearchIO
SearchIO.convert('data/mirna.xml', 'blast-xml', 'results.tab', 'blast-tab')
Out[89]:
(3, 239, 277, 277)